Abstract and keywords
Abstract (English):
For the first time, a study of genetic variability of Caspian anadromous herring was carried out using molecular genetic methods. Sequencing of the cytochrome B site of mitochondrial DNA allowed to identify 7 haplotypes. The most massive haplotype was Hap_Alosa1 noted in 29 herring individuals. Five minor haplotypes were detected in few fish individuals. In the marine period of life in fish caught in the Northern Caspian there were noted rare haplotypes Hap_Alosa6 and Hap_Alosa7. In the river period of life in the Volga herring there was observed Hap_Alosa5. The revealed polymorphism of haplotypes was represented by single nucleotide substitutions. The genetic analysis of migratory herring does not give grounds for isolating the studied fish into separate groups. The marked low level of nucleotide diversity of cytochrome B gene of mitochondrial DNA of the anodromous herring indicates a significant genetic homogeneity of the species within the studied range. The results of analysis of nuclear DNA microsatellite loci showed that only three of the six sites of the studied gene were polymorphic. In individuals caught in the river period of life, only Af20 (out of the 6 loci studied) was polymorphic and was characterized by 4 alleles. In a sample of herring from the Northern Caspian, 3 polymorphic loci (Aa16, Af6 and Af20) were observed, in which 2 alleles were recorded. The observed heterozygosity varied from 0.313 to 0.667 exceeding the level of expected heterozygosity. In polymorphic loci a deficit of heterozygotes was not noted. The results obtained in this study indicate a low level of genetic variation of anadromous herring.

Keywords:
anadromous herring, microsatellite loci, sequencing, genetic polymorphism, Cyt B gene of mitochondrial DNA, haplotypes
Text
Publication text (PDF): Read Download

В систематике проходных сельдей Волжско-Каспийского рыбохозяйственного бассейна в настоящее время не существует четкого и единого мнения. Считается, что каспийская проходная сельдь, обитающая в пределах Волжско-Каспийского рыбохозяйственного бассейна, является политипической формой, представленной двумя подвидами: Alosa kessleri kessleri (Grimm) черноспинка и Alosa kessleri volgensis (Berg) – волжская многотычинковая сельдь [1].

По результатам многолетних исследований считалось, что волжская многотычинковая сельдь отсутствует в промысловых уловах в р. Волга [2], в то время как проходная сельдь-черно-спинка обладает значительным потенциалом воспроизводства.

До строительства плотин на Волге нерест проходных сельдей проходил на обширной акватории от дельты до устья р. Камы. Протяженность нерестовой миграции составляла около
2 000 км. После сооружения каскада гидроузлов нерестилища проходных сельдей сократились более чем в 4 раза. Основной нерест проходит между селами Черный Яр и Светлый Яр [3].
Потеря основной части нерестилищ до 75 % отразилась на их численности – в 1960-е гг. среднегодовой вылов проходных сельдей уменьшился с 16,5 (1960 г.) до 0,21 тыс. т (1968 г.), составив в среднем 4,8 тыс. т. В 1970-е гг. наблюдалось дальнейшее уменьшение вылова, что связано с падением уровня моря и сокращением нагульных площадей. Изменились пути передвижения и места скопления сельдяных косяков, уменьшились зона откорма молоди, выживаемость и численность новых поколений. Вылов проходных сельдей в 1980–1990 гг. не превышал 1,2–1,9 тыс. т. В 2000–2001 гг. под воздействием антропогенных и экологических факторов запасы сельди-черноспинки оказались в состоянии критического минимума. Незаконный промысел на путях миграции производителей, а также антропогенное воздействие на акваторию Каспийского моря [4] сократили ее численность на нерестилищах. Эти факторы повлияли на величину вылова сельди-черноспинки, которая в 2001 г. не превысила 9,0 т [1]. Период 2001–2005 гг. характеризовался самыми низкими показателями вылова (в среднем 4,0 т). Уловы сократились почти в 700 раз, в эти годы остро встал вопрос о сохранении сельди не только как промыслового объекта, но и как биологического вида. Ограничение промышленного лова 2003–2006 гг. позволило сохранить популяцию сельди-черноспинки и способствовало росту ее численности. В последние годы отмечается заметное увеличение общего вылова сельди в р. Волге. В многолетнем аспекте состояние популяции в Волго-Каспийском рыбохозяйственном подрайоне характеризуется устойчивым ростом численности нерестовой части данного вида. Средний показатель вылова сельди-черноспинки с 2006 по 2018 гг. увеличился в 20 раз. Величина ОДУ возросла в 19 раз – с 10,0 т в 2006 г. до 190,0 т в 2018 г.

Литературные сведения о молекулярно-генетических исследованиях каспийской проходной сельди отсутствуют. В связи с этим актуальным является изучение генетической структуры и определение внутривидовых генетических различий этого ценного вида рыб. Для анализа внутривидовой изменчивости и оценки генетического разнообразия наиболее информативным является использование комплекса методов исследования митохондриальной ДНК и ядерных генетических маркеров.

В связи с этим целью работы было исследование генетической изменчивости проходной сельди посредством секвенирования участка гена цитохрома B (Cyt B) митохондриальной
ДНК и набора микросателлитных локусов ядерной ДНК.

 

Материалы и методы исследований

Материалом для исследования послужили особи проходной сельди-черноспинки, выловленные в период нерестового хода с апреля по июнь на акватории Северного Каспия (20 экз.) и на тоневых участках дельты Волги (30 экз.). Рыб отлавливали ставными сетями с ячеей 22–45 мм и речными закидными неводами с ячеей 28 × 36 × 40 мм. Видовая принадлежность определялась на основании общепринятой методики ихтиологических исследований. Визуально обращалось внимание на форму, окраску тела производителей, наличие зубов, а также количество тычинок на первой жаберной дуге [5]. Генетические пробы рыб отбирали прижизненно путем отрезания фрагмента спинного или грудного плавника, фиксировали в 96 %-м этиловом спирте на месте сбора материала. Всем образцам были присвоены индивидуальные коллекционные номера.

Выделение и последующую очистку тотальной ДНК из плавников сельдей проводили на адсорбционных колонках PALL 5051 (AcroPreptTM 96 1 ml filter plate with 1.0 μm Glass Fibermedia, natural housing) в соответствии с протоколом Канадского центра по ДНК-штрихкодированию [6]. Водный раствор ДНК хранили при –20 °С.

Амплификацию участка гена Сyt B митохондриальной ДНК (мтДНК) проводили методом полимеразно-цепной реакции (ПЦР) с использованием праймеров GluDG.L (TGACCTGAARAACCAYCGTTG) и H16460 (CGAYCTTCGGATTACAAGACC) [7] в термоциклерах С-1000, S-1000 (Biorad, USA). Реакционная смесь (ПЦР) объемом 15 мкл состояла из следующих компонентов: 30 мМ трис-HCl (pH 8,6), 16,6 мМ (NH4)2SO4, 2мМ MgCl2, по 100 мкМ каждого dNTP, по 6 пкМ каждого из пары праймеров, 1 ед. ColoredTaq-полимеразы (Силекс, Москва), 4 мкл ДНК (~100 нг), деионизированная вода (milliQ, France) до полного объема.

Полимеразно-цепную реакцию участка гена Сyt B мтДНК проводили в условиях следующего температурного режима: предварительная денатурация при 94 °С – 2 мин, синтез
ПЦР-продуктов (34 циклов): плавление 94 °С – 45 с, отжиг праймеров 53 °С (первые 5 циклов) и 58 °С (последующие 29 циклов) – 45 с, синтез ДНК 72 °С – 90 с. Реакцию завершала
7-минутная стадия элонгации при 72 °С [8].

Секвенирование гена Cyt В (около 1 100 п.н.) мтДНК проводилось с обоих праймеров на ABI-3500 Genetic Аnalyzer (Applied Biosystems, USA) с набором BigDye v.3.1. Анализ полученных нуклеотидных последовательностей проводили в программе Sequencing Analysis 5.4. (Applied Biosystems, USA), множественное выравнивание сиквенсов и построение дендрограмм осуществляли в программе Mega4.0 [9].

Образцы ядерной ДНК проанализированы по шести микросателлитным локусам Cha1020, Cha1059, Aa14, Aa16, Af6, Af20 (табл. 1) [10, 11].

Таблица 1

Праймеры, использованные для амплификации микросателлитных локусов

Локус

Последовательность праймеров (5'–3')

Температура
отжига, °С

Источник информации
о последовательности праймеров

Cha1059

F: CATCTACCACCTCCGACTCC

R: AATCTAAAGGAAGCCCACTC

52

[10]

Cha1020

F: CCTGGAGAGACAGATAGAAAA

R: GAGTTTAGCAGACGCTTTA

52

[10]

Aa14

F: GAGAAGAGGGCATTCG

R: ATTTAGTGTGTGCCCAGC

60

[11]

Aa16

F: TTGACCGAGCGCAAACTG

R: TGACACTGACTCATCATGC

60

[11]

Af6

F: AGGAGATGTTTATCCTGCC

R: CACAGAGGCATAAATGTGG

60

[11]

Af20

F: AATGGACATATCTGCTGG

R: ATGGAGGGCCATATTTCG

60

[11]

 

Реакцию амплификации проводили в объеме 15 мкл (50–100 нг ДНК-матрицы, 30мМ трис-HCl (pH 8,6), 16,6 мМ (NH4)2SO4 (Силекс, Москва), 2мМ MgCl2 (Силекс, Москва), 250 мкМ каждого dNTP, 5–8 пкМ каждого из пары праймеров (Applied Biosistem, USA; Синтол, Евроген, Москва), 1,5 ед. Taq-полимеразы (Силекс, Москва), деионизированная вода (milliQ, Germany)) до полного объема.

Полимеразно-цепную реакцию проводили по следующей схеме: предварительная денатурация при 94 °С – 3 мин, 35 циклов: плавление 94 °С – 30 с, отжиг праймеров 52 °С или 60 °С – 30 с, синтез ДНК 72 °С – 30 с; досинтез ДНК при 72 °С – 3 мин. Амплифицированные продукты подвергали электрофоретическому разделению с помощью системы капиллярного электрофореза ABI-3500 Genetic Аnalyzer (Applied Biosistem, USA), определяя длины фрагментов ДНК в компьютерной программе GeneMapper 4.1.

Для оценки молекулярно-генетического полиморфизма использовали программное обеспечение GenAlEx6 [12]. Генетическое разнообразие оценивали по следующим показателям: число аллелей, частоты аллелей, наблюдаемая и ожидаемая гетерозиготность и индекс фиксации Райта, отражающий уровень инбридинга особи относительно популяции.

 

Результаты исследования и их обсуждение

Согласно результатам ихтиологических наблюдений, собранным специалистами «КаспНИРХа» в 1970–2018 гг., после зарегулирования р. Волги нерестовая часть популяции проходной сельди на рыболовных участках Астраханской области представлена одним видом (подвидом) – сельдью-черноспинкой.

Секвенирование участка гена Cyt B мтДНК. Небольшой размер и большое число копий в клетке позволяют мтДНК быть оптимальным и информативным материалом для генетических исследований.

В данном исследовании по гену Cyt B мтДНК у особей проходной сельди, выловленной
в р. Волга и Северном Каспии, выявлено 7 различных митохондриальных гаплотипов (табл. 2, рис. 1).

Таблица 2

Генетическая гетерогенность проходной сельди

Гаплотип

Место вылова

Нуклеотидная замена

Количество особей, экз.

Hap_Alosa1

Северный Каспий

A→G

11

р. Волга

18

Hap_Alosa2

Северный Каспий

G→A

6

р. Волга

6

Hap_Alosa3

Северный Каспий

G→A

T→C

1

р. Волга

3

Hap_Alosa4

Северный Каспий

A→G

1

р. Волга

1

Hap_Alosa5

Северный Каспий

G→A

р. Волга

1

Hap_Alosa6

Северный Каспий

A→G

1

р. Волга

Hap_Alosa7

Северный Каспий

G→A

1

р. Волга

Рис. 1. Дендрограмма (NJ) генетического сходства последовательностей гена
Cyt B проходной сельди. В скобках указано количество рыб с данным гаплотипом, экз.
Шкала соответствует 5 заменам на 10 000 нуклеотидных остатков

 

У рыб преобладали гаплотипы Hap_Alosa1 (29 экз.) и Hap_Alosa2 (12 экз.). Количество особей с Hap_Alosa1 и Hap_Alosa3 мтДНК по гену Cyt B было выше в р. Волга. Гаплотипы Hap_Alosa2 и Hap_Alosa4 у рыб из Северного Каспия и р. Волга отмечены в равном соотношении.

Также были зафиксированы минорные гаплотипы, наблюдаемые только в выборке с Северного Каспия (Hap_Alosa6 и Hap_Alosa7) и у особей, выловленных в р. Волга (Hap_Alosa5).
У проанализированных гаплотипов выявлен незначительный полиморфизм, представленный однонуклеотидными заменами (см. табл. 2).

Дендрограмма демонстрирует небольшое генетическое расстояние между исследованными особями сельди (см. рис. 1). Очевидно, что все особи группируются в единый кластер.

Выявлен низкий уровень нуклеотидного разнообразия гена Cyt B мтДНК в исследованной выборке проходной сельди, что свидетельствует о значительной генетической однородности вида в пределах изученного ареала. Полученные результаты генетических особенностей проходной сельди в р. Волге и Каспийском море не дают оснований для выделения особей в отдельные кластеры.

Микросателлитный анализ. По результатам микросателлитного анализа исследованные особи сельди отличались низким уровнем генетического полиморфизма, в выборках из р. Волги и Северного Каспия отмечено по 9 аллелей. Три проанализированных локуса были мономорфными в обеих выборках. В микросателлите Cha1020 зафиксирован аллель размером 128 п.н., в Аа14 – 140 п.н., в Cha1059 – 127 п.н. (рис. 2).

 

Описание: Описание: F:\2019\статья сельдь\1.jpg Описание: Описание: F:\2019\статья сельдь\2.jpg

 

                                  Локус Cha1059                                                        Локус Aa16

 

Рис. 2. Пример хроматограммы продуктов ПЦР локусов ядерной ДНК
одной особи проходной сельди.
Данный индивид гомозиготен по локусу
Cha1059 (длина аллеля 127 п.н.),
гетерозиготен – по локусу
Aa16 (длина аллелей 141, 143 п.н.)

Согласно литературным данным участок гена Cha1020, апробированный ранее для анализа генетической изменчивости сельди Белого моря (Clupea pallasii marisalbi) и атлантической сельди (Clupea harengus), отличался высоким уровнем полиморфизма и был представлен 7–21 аллелями, локус Cha1059 характеризовался 4–6 аллелями [10, 11]. Микросателлит Aa14 был использован для исследования каспийско-черноморских сельдей (Alosa alosa и Alosa fallax) и, по данным авторов, был представлен 3–4 аллелями [11]. Участки гена Aa16 (рис. 2, 3) и Af6 (рис. 3) характеризовались 2 аллелями.

 

 

Рис. 3. Аллели полиморфных локусов проходной сельди и их частоты

 

В локусе Af20 (рис. 3) отмечено максимум 4 вариации.

У особей, выловленных в р. Волге, из 6 изученных локусов только Af20 был полиморфным. В данном участке гена выявлено 4 аллеля, наибольшая частота – 0,58 ед. – отмечена у аллеля 176 п.н. (рис. 3), наблюдаемая гетерозиготность превышала теоретически ожидаемую, индекс фиксации Райта характеризовался отрицательными значениями (–0,116), что указывает на отсутствие дефицита гетерозигот (табл. 3).

Таблица 3

Характеристика микросателлитных локусов проходной сельди

Место вылова

Локус

Число аллелей

Наблюдаемая гетерозиготность

Ожидаемая

гетерозиготность

Индекс фиксации Райта

р. Волга

Cha1020

Мономорфный локус

Cha1059

Мономорфный локус

Aa14

Мономорфный локус

Aa16

Мономорфный локус

Af6

Мономорфный локус

Af20

4,000

0,667

0,597

–0,116

Северный Каспий

Cha1020

Мономорфный локус

Cha1059

Мономорфный локус

Aa14

Мономорфный локус

Aa16

2,000

0,313

0,264

–0,185

Af6

2,000

0,333

0,278

–0,200

Af20

2,000

0,500

0,500

0,000

 

В выборке с Северного Каспия наблюдалось 3 полиморфных локуса (см. рис. 3, табл. 3), в которых фиксировалось по 2 аллеля. В локусе Aa16 отмечены аллели 141 п.н. и 143 п.н., ожидаемая гетерозиготность была ниже наблюдаемой, индекс фиксации Райта принимал отрицательные значения (–0,185). Участок гена Af6 характеризовался аллелями 142 п.н. и 144 п.н., зафиксирован избыток гетерозигот (индекс фиксации составил –0,200). В микросателлите Af20 наблюдалось 2 аллеля с равными частотами 0,50 ед. (см. рис. 3, табл. 3).

Заключение

Впервые проведены исследования генетической изменчивости проходной сельди с использованием молекулярно-генетических методов. Полученные с помощью секвенирования участка Cyt B мтДНК данные позволили предположить низкий уровень генетической изменчивости сельди. Исследования локусов ядерной ДНК показали низкий уровень полиморфизма по шести микросателлитам. Выявленные полиморфные локусы указывают на необходимость продолжения работы по составлению оптимальной панели микросателлитов для проходной сельди. Данные о генетической изменчивости являются чрезвычайно важными для устойчивого управления процессом рыболовства с учетом сохранения эволюционно сложившегося биоразнообразия рыб.

References

1. Voinova T. V. Dinamika ulovov i biologicheskie pokazateli sel'di-chernospinki v Volgo-Kaspiiskom rybokhoziaistvennom podraione v sovremennykh usloviiakh (r. Volga i ee vodotoki) [Catch dynamics and biological indicators of black-backed herring in the Volga-Caspian fisheries subarea in modern conditions (the Volga River and its watercourses)]. Vestnik Astrakhanskogo gosudarstvennogo tekhnicheskogo universiteta. Seriia: Rybnoe khoziaistvo, 2013, no. 3, pp. 25-29.

2. Vodovskaia V. V. Ekologicheskie aspekty biologii prokhodnoi sel'di Kaspiia [Ecological aspects of biology of migratory herring in the Caspian]. Astrakhan', Izd-vo KaspNIRKh, 2001. 74 p.

3. Vodovskaia V. V. Ekologiia kaspiiskoi prokhodnoi sel'di (Alosa kessleri) na Nizhnei Volge v sovremennykh usloviiakh gidrologicheskogo rezhima. Avtoreferat dis. … kand. biol. nauk [Ecology of Caspian migratory herring (Alosa kessleri) in the Lower Volga in modern conditions of hydrological regime: Diss.Abstr. ... Cand.Biol.Sci.]. Moscow, Izd-vo VNIRO, 1984. 24 p.

4. Lepilina I. N., Nikolenkov A. A., Voinova T. V., Stepanova T. G. Sostoianie zapasov sel'di-chernospinki, biologicheskie, fiziologo-biokhimicheskie pokazateli i trofologicheskii analiz proizvoditelei, migriruiushchikh v reku Volgu [Stock status of black-back herring, biological, physiological and biochemical parameters and trophological analysis of producers migrating to the Volga River]. Vestnik Astrakhanskogo gosudarstvennogo tekhnicheskogo universiteta. Seriia: Rybnoe khoziaistvo, 2016, no. 2, pp. 43-52.

5. Pravdin I. F. Rukovodstvo po izucheniiu ryb [Fish study guide]. Moscow, Pishchevaia promyshlennost' Publ., 1966. 376 p.

6. Ivanova N. V., deWaard J., Hebert P. D. N. An inexpensive, automation friendly protocol for recovering high quality DNA. Molecular Ecology Notes, 2006, vol. 6, pp. 998-1002.

7. Palumbi S. R. Nucleic acids II: the polymerase chain reaction. Molecular systematics, 1996, pp. 205-247.

8. Vergara-Chen C., Aguirre W. E., González-Wangüemert M., Bermingham E. A mitochondrial DNA based phylogeny of weakfish species of the Cynoscion group (Pisces: Sciaenidae). Molecular Phylogenetic Evolution, 2009, vol. 53 (2), pp. 602-607.

9. Tamura K., Dudley J., Nei M. & Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 2007, vol. 24, pp. 1596-1599.

10. McPherson A. A., O’Reilly P. T., McParland T. L. et al. Isolation of nine novel tetranucleotide microsatellitesin Atlantic herring (Clupea harengus). Molecular Ecology Notes, 2001, no. 1, pp. 31-32.

11. Faria R., Wallner B., Weiss S., Alexandrino P. Isolation and characterization of eight dinucleotide microsatellite loci from two closely related clupeid species (Alosa alosa and A. fallax). Molecular Ecology Notes, 2004, vol. 4, pp. 586-588.

12. Peakall R., Smouse P. E. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes, 2006, vol. 6, pp. 288-295.