Abstract and keywords
Abstract (English):
The analysis of genetic diversity on the nuclear (microsatellites) DNA markers of the Russian sturgeon manufacturers in aquaculture conditions is made. All of the analyzed fish in five studied loci (An 20, Afug 41, Afug 51, AoxD 165, AoxD 161) revealed 74 allele. The highest allelic polymorphism was observed in 41 loci Afug, AoxD 161. The high degree of heterozygosity of Russian sturgeon manufacturers, used in the artificial reproduction of sturgeon, is marked.

Keywords:
Russian sturgeon, microsatellite, allele, polymorphism, heterozygosity
Text
Publication text (PDF): Read Download

Введение В настоящее время в России и других странах распространена практика одомашнивания и искусственного выращивания осетровых рыб. В сложившейся ситуации необходимо применение наиболее современных и совершенных способов мониторинга генетических процессов, протекающих в искусственно воспроизводимых популяциях и промышленных стадах осетровых рыб. Результаты молекулярно-генетических анализов должны ложиться в основу подбора пар производителей для скрещивания, селекции и получения жизнестойкого потомства с наименьшим отходом на стадиях развития и выращивания [1–3]. Молекулярно-генетические исследования рыб позволят достоверно определить таксономическую принадлежность каждой особи и составить индивидуальные генетические паспорта. Основным показателем в генетическом паспорте являются микросателлитные маркеры, определяющие индивидуальность каждой особи, что важно для подбора пар производителей при скрещивании для получения эффекта гетерозиса, повышения выживаемости личинок и мальков осетровых рыб и, соответственно, повышения качества товарного выращивания. Микросателлитные локусы – это полиморфные последовательности ДНК, содержащие короткие повторяющиеся последовательности нуклеотидов. Микросателлитные локусы распределены по консервативным, мало изменяющимся регионам ДНК геномов и могут демонстрировать высокие уровни внутривидового аллельного полиморфизма. Уникальные последовательности ДНК, расположенные по границам фланкирующих повторов, могут быть использованы для идентификации и дальнейшей характеристики геномных регионов, окружающих эти локусы [4]. Целью исследований было выявление генетического разнообразия доместицированных стад русского осетра (Acipenser güldenstädtii) на научно-экспериментальной базе Каспийского научно-исследовательского института рыбного хозяйства (НЭБ КаспНИРХ) – центр «БИОС». Для достижения поставленной цели был проведен анализ генетического разнообразия русского осетра по пяти микросателлитным локусам ядерной ДНК. Материал и методы исследования Материалом для молекулярно-генетического анализа служили пробы 31 фрагмента плавников производителей русского осетра (Acipenser güldenstädtii) (20 экз. самок, 11 экз. самцов). Тканевые пробы плавников рыб отбирали прижизненно, фиксировали в 96 %-м этаноле и хранили в морозильной камере. Тотальную ДНК выделяли из фрагментов плавников методом солевой экстракции [5]. Микросателлитный анализ ядерной ДНК проводили методом, первоначально разработанным для видов A. naccarii [6], A. fulvescens [7] и A. oxyrinchus [8] по пяти микросателлитным локусам: An 20, Afug 41, Afug 51, AoxD 165, AoxD 161 с флюоресцентными метками (табл.). Условия проведения полимеразной цепной реакции (ПЦР) были оптимизированы для исследуемого вида A. güldenstädtii. Реакционная смесь ПЦР для микросателлитного анализа (STR) объемом 15 мкл состояла из следующих компонентов: реакционный буфер – 10 мМ (Силекс, Москва); MgCl2 – 25 мM (Силекс, Москва); dNTPs – 2,5 мM (Силекс, Москва); термостабильная полимераза – 5,0 U (Силекс, Москва); праймеры – 10 Пмоль (Aplied Biosistem, USA), ДНК – 3 мкл; деионизированная вода (milliQ) до полного объема. Амплификация ДНК, выделенной из образцов, осуществлялась в термоциклере BIORAD С-1000. Локусы для микросателлитного анализа Локус Последовательность (5'–3') Размер аллелей, п. н. An 20 F:AATAACAATCATTACATGAGGCT R:TGGTCAGTTGTTTTTTTATTGAT 129–187 Afug 41 F:TGACGCACAGTAGTATTATTTATG R:TGATGTTTGCTGAGGCTTTTC 173–265 Afug 51 F:ATAATAATGAGCGTGCTTTCTGTT R:ATTCCGCTTGCGACTTATTTA 188–278 AoxD 165 F: TTTGACAGCTCCTAAGTGATACC R: AAAGCCCTACAACAAATGTCAC 140–208 AoxD 161 F:CATTCAGTATGAGACAGACACTC R:ATCTCAGGGACTGCTGTGATTGG 280–360 При проведении микросателлитного анализа ПЦР-продукты подвергали капиллярному электрофоретическому разделению, STR-спектры ядерной ДНК анализировали на приборе Genetic Analyzer 3500 с использованием компьютерной программы «Gene Mapper». Для каждого микросателлитного локуса были определены число аллелей и их размер – пары нуклеотидов (п. н.) в соответствии с капиллярной электрофоретической подвижностью ПЦР-продукта. Генетическую гетерогенности выборок оценивали по частоте встречаемости аллелей в локусе, уровню наблюдаемой гетерозиготности – Н0 [9]. Результаты исследований и их обсуждение Микросателлитный анализ локусов ядерной ДНК осетровых рыб позволяет оценить генетическое разнообразие осетровых рыб, выявить индивидуальные особенности рыб и, соответственно, повысить продуктивные качества выращиваемой товарной рыбы. Полиморфность, гетерозиготность, разнообразие комбинаций аллелей определяют богатство генофонда вида. Чем выше уровень гетерозиготности, тем больше количество различных сочетаний аллелей у потомства. Уменьшение численности вида естественно ведет к сокращению аллельного разнообразия и количества комбинаций, поэтому важно сохранить генофонд диких видов, не допускать их резкого обеднения. У всех проанализированных производителей русского осетра, содержащихся на НЭБ КаспНИРХ – центр «БИОС» по пяти исследованным локусам выявлено 74 аллеля. Число аллелей на локус колебалось от 11 (An 20) до 19 (AoxD161). Наибольший полиморфизм проявили локусы Afug 41 и AoxD 161 с размерными диапазонами аллелей 173–253 и 284–336 п. н. соответственно. Наименее полиморфным в выборке оказался локус An 20 с размерным диапазоном 145–189 п. н. Результаты исследования геномной ДНК у осетров выявили преобладание в локусах An 20 аллеля 165 п. н. (33 %), в Afug 41 – 197 п. н. (21 %), в Afug 51 – 232 п. н. (30 %), в AoxD 165–178 п. н. (37 %), в AoxD 165–316 п. н. (15 %) (рис. 1, 2). Рис. 1. Распределение аллелей локуса An 20 в ядерной ДНК производителей русского осетра Рис. 2. Распределение аллелей локуса Afug 41 в ядерной ДНК производителей русского осетра Анализ генетического разнообразия производителей русского осетра выявил высокие значения наблюдаемой гетерозиготности (Н0) по микросателлитным локусам от 0,935 до 1,0, что свидетельствует о высокой степени гетерозиготности исследованных особей. Средняя гетерозиготность и число аллелей на локус характеризуют уровень генетического разнообразия, от которого зависит интенсивность процессов, протекающих в природных популяциях, и выживаемость популяции. Генетическое разнообразие или генетический полиморфизм (один из компонентов генетической характеристики популяции или вида) имеет большое значение для экологической пластичности популяции, позволяет популяции адаптироваться к изменяющимся условиям среды обитания. По пяти микросателлитным локусам проведена паспортизация исследованных производителей русского осетра, использованных в искусственном воспроизводстве. Данные индивидуального генетического паспорта рыбы вносятся в общую базу данных. При необходимости, по образцу икры или плавника можно определить принадлежность не просто к тому или иному виду, а к хозяйству, где была получена рыба, и подтвердить, от какой рыбы получена икра или продукция. Заключение Анализ генетического разнообразия производителей русского осетра по микросателлитным локусам (An 20, Afug 41, Afug 51, AoxD 165, AoxD 161) выявил 74 аллеля. Число аллелей на локус варьировало от 11 (An 20) до 19 (AoxD161). Показатели наблюдаемой гетерозиготности (Н0) в диапазоне от 0,935 до 1,0 свидетельствует о высоком генетическом разнообразии производителей русского осетра, участвующих в искусственном воспроизводстве на НЭБ КаспНИРХ – центр «БИОС». Генотипирование производителей осетровых, потомство которых выпускают в естественную среду, позволяет оценить вклад НЭБ КаспНИРХ – центр «БИОС» в сохранение разнообразия естественной популяции осетровых. Разноплановые комплексные молекулярно-генетические исследования необходимы для сохранения генофонда и развития осетроводства. Эти методы эффективны, перспективны в аквакультуре осетровых рыб и доказывают необходимость их использования на осетровых рыбоводных заводах Волжско-Каспийского бассейна для определения вклада каждого предприятия в пополнение запасов Каспийского бассейна.
References

1. Allendorf F. U. Genetika i upravlenie rybnym hozyaystvom / F. U. Allendorf, N. Riman, F. M. Atter / Populyacionnaya genetika i upravlenie rybnym hozyaystvom. M.: Agropromizdat, 1991. S. 15–36.

2. Ryabova G. D. Geneticheskaya izmenchivost' prirodnyh populyaciy i domesticirovannyh stad osetrovyh Rossii (atlas allozimov) / G. D. Ryabova, V. O. Klimonov, E. I. Shishanova. M.: Rossel'hozakademiya, 2008. 94 s.

3. Myuge N. S. Polimorfizm kontrol'nogo regiona mitohondrial'noy DNK vos'mi vidov osetrovyh i razrabotka sistemy DNK-identifikacii vidov / N. S. Myuge, A. E. Barminceva, S. M. Rastorguev, V. N. Myuge, V. A. Barmincev // Genetika. 2008. T. 44. S. 1–7.

4. Waldbieser G. C. A Microsatellite-Based Genetic Linkage Map for Channel Catfish, Ictalurus punctatus / G. C. Waldbieser // Aquaculture. 1999. 32. R. 43–49.

5. Aljanabi S. M. Universal and rapid salt extraction of high quality gnomic DNA for PCR – based techniques / S. M. Aljanabi, I. Martinez // Nucl. Acids Res. 1997. Vol. 25 (20). P. 4692–4693.

6. Zane L. Isolation and characterization of microsatellites in the Adriatic sturgeon (Acipenser naccarii) / L. Zane, T. Patarnello, A. Ludwig et al. // Mol. Ecol. Notes. 2002. Vol. 2. P. 586–588.

7. Welsh A. B. Indentificatiob of microsatellite loci in lake sturgeon. Acipencer fulvescens, and their variability in green sturgeon, A. medirostris / A. B. Welsh, M. Blumberg, B. May // Mol. Ecol. Notes. 2003. Vol. 3. P. 47–55.

8. King T. L. Microsatellite DNA variation in Atlantic sturgeon (Acipencer oxyrinchus) and cross-species amplification in the Acipenceridae / T. L. King, B. A. ALubinski, A. P. Spidle // Cons. Gen. 2001. Vol. 2. 103–119.

9. Ayla F. Vvedenie v populyacionnuyu i evolyucionnuyu genetiku / F. M. Ayla. M.: Mir, 1984. 232 s.